plko 1 puro constructs (Addgene inc)
Addgene inc is a verified supplier 
96
Structured Review
Addgene inc
plko 1 puro constructs
Plko 1 Puro Constructs, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1562 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/plko%2E1/pLKO%2E1+puro+(Plasmid+%238453)/pmc13010945-62-9-16
Average 96 stars, based on 1562 article reviews
Plko 1 Puro Constructs, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1562 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/plko%2E1/pLKO%2E1+puro+(Plasmid+%238453)/pmc13010945-62-9-16
Average 96 stars, based on 1562 article reviews
plko 1 puro constructs - by Bioz Stars,
2026-09
96/100 stars
Images
Related Articles
shRNA:Article Title: Telomere-to-mitochondria signalling by ZBP1 mediates replicative crisis. Article Snippet: HMECs: vector siCtrl versus siMAVS (>0.9999); vector siCtrl versus siIFNAR2 (>0.9999); Flag–ZBP1(S)–FIS1 siCtrl versus siMAVS (<0.0001); Flag–ZBP1(S)–FIS1 siCtrl versus siIFNAR2 (<0.0001). shRNAs shRNAs were as follows: Scramble, CCTAAGGTTAAGTCGCCCTCGCTC GAGCGAGGGCGACTTAACCTTAGG, Article Title: ERBB4 selectively amplifies TGF-β pro-metastatic responses. Article Snippet: Article ERBB4 selectively amplifie s TGF-b pro-metastatic responses Article Title: IGSF3 is a homophilic cell adhesion molecule that drives lung metastasis of melanoma by promoting adhesion to vascular endothelium Article Snippet: The Article Title: PARP1-driven repair of topoisomerase IIIα DNA-protein crosslinks by FEN1. Article Snippet: Article PARP1-driven repair of top oisomerase IIIa DNAprotein crosslinks by FEN1 Article Title: BNIP3L/NIX-mediated mitophagy alleviates passive stress-coping behaviors induced by tumor necrosis factor-α. Article Snippet: Article Article Title: IGSF3 is a homophilic cell adhesion molecule that drives lung metastasis of melanoma by promoting adhesion to vascular endothelium. Article Snippet: The Article Title: Overexpression of PPM1B inhibited chemoresistance to temozolomide and proliferation in glioma cells. Article Snippet: Funding information National Natural Science Foundation of China, Grant/Award Number: 81860450; Basic Research Project in Guizhou Province, Grant/Award Numbers: [2018]1425, [2021] YB473, [2023]552; Young Talents Found of Zunyi Medical University, Grant/Award Number: 18zy‐005 Abstract Protein phosphatase magnesium‐dependent 1B (PPM1B) functions as IKKβ phosphatases to terminate nuclear factor kappa B (NF‐κB) signaling.. NF‐κB signaling was constitutively activated in glioma cells.. At present, little is known about the role of PPM1B in glioma. Article Title: PARP1-driven repair of topoisomerase IIIα DNA-protein crosslinks by FEN1 Article Snippet: shRNA oligonucleotides targeting human FEN1, using following primers were cloned into Clone Assay:Article Title: Telomere-to-mitochondria signalling by ZBP1 mediates replicative crisis. Article Snippet: HMECs: vector siCtrl versus siMAVS (>0.9999); vector siCtrl versus siIFNAR2 (>0.9999); Flag–ZBP1(S)–FIS1 siCtrl versus siMAVS (<0.0001); Flag–ZBP1(S)–FIS1 siCtrl versus siIFNAR2 (<0.0001). shRNAs shRNAs were as follows: Scramble, CCTAAGGTTAAGTCGCCCTCGCTC GAGCGAGGGCGACTTAACCTTAGG, Article Title: ERBB4 selectively amplifies TGF-β pro-metastatic responses. Article Snippet: Article ERBB4 selectively amplifie s TGF-b pro-metastatic responses Article Title: IGSF3 is a homophilic cell adhesion molecule that drives lung metastasis of melanoma by promoting adhesion to vascular endothelium Article Snippet: The Article Title: PARP1-driven repair of topoisomerase IIIα DNA-protein crosslinks by FEN1. Article Snippet: Article PARP1-driven repair of top oisomerase IIIa DNAprotein crosslinks by FEN1 Article Title: BNIP3L/NIX-mediated mitophagy alleviates passive stress-coping behaviors induced by tumor necrosis factor-α. Article Snippet: Article Article Title: IGSF3 is a homophilic cell adhesion molecule that drives lung metastasis of melanoma by promoting adhesion to vascular endothelium. Article Snippet: The Article Title: Overexpression of PPM1B inhibited chemoresistance to temozolomide and proliferation in glioma cells. Article Snippet: Funding information National Natural Science Foundation of China, Grant/Award Number: 81860450; Basic Research Project in Guizhou Province, Grant/Award Numbers: [2018]1425, [2021] YB473, [2023]552; Young Talents Found of Zunyi Medical University, Grant/Award Number: 18zy‐005 Abstract Protein phosphatase magnesium‐dependent 1B (PPM1B) functions as IKKβ phosphatases to terminate nuclear factor kappa B (NF‐κB) signaling.. NF‐κB signaling was constitutively activated in glioma cells.. At present, little is known about the role of PPM1B in glioma. Article Title: PARP1-driven repair of topoisomerase IIIα DNA-protein crosslinks by FEN1 Article Snippet: shRNA oligonucleotides targeting human FEN1, using following primers were cloned into Control:Article Title: Telomere-to-mitochondria signalling by ZBP1 mediates replicative crisis. Article Snippet: HMECs: vector siCtrl versus siMAVS (>0.9999); vector siCtrl versus siIFNAR2 (>0.9999); Flag–ZBP1(S)–FIS1 siCtrl versus siMAVS (<0.0001); Flag–ZBP1(S)–FIS1 siCtrl versus siIFNAR2 (<0.0001). shRNAs shRNAs were as follows: Scramble, CCTAAGGTTAAGTCGCCCTCGCTC GAGCGAGGGCGACTTAACCTTAGG, Article Title: ERBB4 selectively amplifies TGF-β pro-metastatic responses. Article Snippet: Article ERBB4 selectively amplifie s TGF-b pro-metastatic responses Article Title: IGSF3 is a homophilic cell adhesion molecule that drives lung metastasis of melanoma by promoting adhesion to vascular endothelium Article Snippet: The Article Title: PARP1-driven repair of topoisomerase IIIα DNA-protein crosslinks by FEN1. Article Snippet: Article PARP1-driven repair of top oisomerase IIIa DNAprotein crosslinks by FEN1 Article Title: BNIP3L/NIX-mediated mitophagy alleviates passive stress-coping behaviors induced by tumor necrosis factor-α. Article Snippet: Article Article Title: IGSF3 is a homophilic cell adhesion molecule that drives lung metastasis of melanoma by promoting adhesion to vascular endothelium. Article Snippet: The Article Title: Overexpression of PPM1B inhibited chemoresistance to temozolomide and proliferation in glioma cells. Article Snippet: Funding information National Natural Science Foundation of China, Grant/Award Number: 81860450; Basic Research Project in Guizhou Province, Grant/Award Numbers: [2018]1425, [2021] YB473, [2023]552; Young Talents Found of Zunyi Medical University, Grant/Award Number: 18zy‐005 Abstract Protein phosphatase magnesium‐dependent 1B (PPM1B) functions as IKKβ phosphatases to terminate nuclear factor kappa B (NF‐κB) signaling.. NF‐κB signaling was constitutively activated in glioma cells.. At present, little is known about the role of PPM1B in glioma. Article Title: PARP1-driven repair of topoisomerase IIIα DNA-protein crosslinks by FEN1 Article Snippet: shRNA oligonucleotides targeting human FEN1, using following primers were cloned into Plasmid Preparation:Article Title: Telomere-to-mitochondria signalling by ZBP1 mediates replicative crisis. Article Snippet: HMECs: vector siCtrl versus siMAVS (>0.9999); vector siCtrl versus siIFNAR2 (>0.9999); Flag–ZBP1(S)–FIS1 siCtrl versus siMAVS (<0.0001); Flag–ZBP1(S)–FIS1 siCtrl versus siIFNAR2 (<0.0001). shRNAs shRNAs were as follows: Scramble, CCTAAGGTTAAGTCGCCCTCGCTC GAGCGAGGGCGACTTAACCTTAGG, Article Title: ERBB4 selectively amplifies TGF-β pro-metastatic responses. Article Snippet: Article ERBB4 selectively amplifie s TGF-b pro-metastatic responses Article Title: IGSF3 is a homophilic cell adhesion molecule that drives lung metastasis of melanoma by promoting adhesion to vascular endothelium Article Snippet: The Article Title: PARP1-driven repair of topoisomerase IIIα DNA-protein crosslinks by FEN1. Article Snippet: Article PARP1-driven repair of top oisomerase IIIa DNAprotein crosslinks by FEN1 Article Title: BNIP3L/NIX-mediated mitophagy alleviates passive stress-coping behaviors induced by tumor necrosis factor-α. Article Snippet: Article Article Title: IGSF3 is a homophilic cell adhesion molecule that drives lung metastasis of melanoma by promoting adhesion to vascular endothelium. Article Snippet: The Article Title: Overexpression of PPM1B inhibited chemoresistance to temozolomide and proliferation in glioma cells. Article Snippet: Funding information National Natural Science Foundation of China, Grant/Award Number: 81860450; Basic Research Project in Guizhou Province, Grant/Award Numbers: [2018]1425, [2021] YB473, [2023]552; Young Talents Found of Zunyi Medical University, Grant/Award Number: 18zy‐005 Abstract Protein phosphatase magnesium‐dependent 1B (PPM1B) functions as IKKβ phosphatases to terminate nuclear factor kappa B (NF‐κB) signaling.. NF‐κB signaling was constitutively activated in glioma cells.. At present, little is known about the role of PPM1B in glioma. Article Title: PARP1-driven repair of topoisomerase IIIα DNA-protein crosslinks by FEN1 Article Snippet: shRNA oligonucleotides targeting human FEN1, using following primers were cloned into Transfection:Article Title: Telomere-to-mitochondria signalling by ZBP1 mediates replicative crisis. Article Snippet: HMECs: vector siCtrl versus siMAVS (>0.9999); vector siCtrl versus siIFNAR2 (>0.9999); Flag–ZBP1(S)–FIS1 siCtrl versus siMAVS (<0.0001); Flag–ZBP1(S)–FIS1 siCtrl versus siIFNAR2 (<0.0001). shRNAs shRNAs were as follows: Scramble, CCTAAGGTTAAGTCGCCCTCGCTC GAGCGAGGGCGACTTAACCTTAGG, Article Title: ERBB4 selectively amplifies TGF-β pro-metastatic responses. Article Snippet: Article ERBB4 selectively amplifie s TGF-b pro-metastatic responses Article Title: IGSF3 is a homophilic cell adhesion molecule that drives lung metastasis of melanoma by promoting adhesion to vascular endothelium Article Snippet: The Article Title: PARP1-driven repair of topoisomerase IIIα DNA-protein crosslinks by FEN1. Article Snippet: Article PARP1-driven repair of top oisomerase IIIa DNAprotein crosslinks by FEN1 Article Title: BNIP3L/NIX-mediated mitophagy alleviates passive stress-coping behaviors induced by tumor necrosis factor-α. Article Snippet: Article Article Title: IGSF3 is a homophilic cell adhesion molecule that drives lung metastasis of melanoma by promoting adhesion to vascular endothelium. Article Snippet: The Article Title: Overexpression of PPM1B inhibited chemoresistance to temozolomide and proliferation in glioma cells. Article Snippet: Funding information National Natural Science Foundation of China, Grant/Award Number: 81860450; Basic Research Project in Guizhou Province, Grant/Award Numbers: [2018]1425, [2021] YB473, [2023]552; Young Talents Found of Zunyi Medical University, Grant/Award Number: 18zy‐005 Abstract Protein phosphatase magnesium‐dependent 1B (PPM1B) functions as IKKβ phosphatases to terminate nuclear factor kappa B (NF‐κB) signaling.. NF‐κB signaling was constitutively activated in glioma cells.. At present, little is known about the role of PPM1B in glioma. Article Title: PARP1-driven repair of topoisomerase IIIα DNA-protein crosslinks by FEN1 Article Snippet: shRNA oligonucleotides targeting human FEN1, using following primers were cloned into Over Expression:Article Title: Telomere-to-mitochondria signalling by ZBP1 mediates replicative crisis. Article Snippet: HMECs: vector siCtrl versus siMAVS (>0.9999); vector siCtrl versus siIFNAR2 (>0.9999); Flag–ZBP1(S)–FIS1 siCtrl versus siMAVS (<0.0001); Flag–ZBP1(S)–FIS1 siCtrl versus siIFNAR2 (<0.0001). shRNAs shRNAs were as follows: Scramble, CCTAAGGTTAAGTCGCCCTCGCTC GAGCGAGGGCGACTTAACCTTAGG, Article Title: ERBB4 selectively amplifies TGF-β pro-metastatic responses. Article Snippet: Article ERBB4 selectively amplifie s TGF-b pro-metastatic responses Article Title: IGSF3 is a homophilic cell adhesion molecule that drives lung metastasis of melanoma by promoting adhesion to vascular endothelium Article Snippet: The Article Title: PARP1-driven repair of topoisomerase IIIα DNA-protein crosslinks by FEN1. Article Snippet: Article PARP1-driven repair of top oisomerase IIIa DNAprotein crosslinks by FEN1 Article Title: BNIP3L/NIX-mediated mitophagy alleviates passive stress-coping behaviors induced by tumor necrosis factor-α. Article Snippet: Article Article Title: IGSF3 is a homophilic cell adhesion molecule that drives lung metastasis of melanoma by promoting adhesion to vascular endothelium. Article Snippet: The Article Title: Overexpression of PPM1B inhibited chemoresistance to temozolomide and proliferation in glioma cells. Article Snippet: Funding information National Natural Science Foundation of China, Grant/Award Number: 81860450; Basic Research Project in Guizhou Province, Grant/Award Numbers: [2018]1425, [2021] YB473, [2023]552; Young Talents Found of Zunyi Medical University, Grant/Award Number: 18zy‐005 Abstract Protein phosphatase magnesium‐dependent 1B (PPM1B) functions as IKKβ phosphatases to terminate nuclear factor kappa B (NF‐κB) signaling.. NF‐κB signaling was constitutively activated in glioma cells.. At present, little is known about the role of PPM1B in glioma. Article Title: PARP1-driven repair of topoisomerase IIIα DNA-protein crosslinks by FEN1 Article Snippet: shRNA oligonucleotides targeting human FEN1, using following primers were cloned into Expressing:Article Title: Telomere-to-mitochondria signalling by ZBP1 mediates replicative crisis. Article Snippet: HMECs: vector siCtrl versus siMAVS (>0.9999); vector siCtrl versus siIFNAR2 (>0.9999); Flag–ZBP1(S)–FIS1 siCtrl versus siMAVS (<0.0001); Flag–ZBP1(S)–FIS1 siCtrl versus siIFNAR2 (<0.0001). shRNAs shRNAs were as follows: Scramble, CCTAAGGTTAAGTCGCCCTCGCTC GAGCGAGGGCGACTTAACCTTAGG, Article Title: ERBB4 selectively amplifies TGF-β pro-metastatic responses. Article Snippet: Article ERBB4 selectively amplifie s TGF-b pro-metastatic responses Article Title: IGSF3 is a homophilic cell adhesion molecule that drives lung metastasis of melanoma by promoting adhesion to vascular endothelium Article Snippet: The Article Title: PARP1-driven repair of topoisomerase IIIα DNA-protein crosslinks by FEN1. Article Snippet: Article PARP1-driven repair of top oisomerase IIIa DNAprotein crosslinks by FEN1 Article Title: BNIP3L/NIX-mediated mitophagy alleviates passive stress-coping behaviors induced by tumor necrosis factor-α. Article Snippet: Article Article Title: IGSF3 is a homophilic cell adhesion molecule that drives lung metastasis of melanoma by promoting adhesion to vascular endothelium. Article Snippet: The Article Title: Overexpression of PPM1B inhibited chemoresistance to temozolomide and proliferation in glioma cells. Article Snippet: Funding information National Natural Science Foundation of China, Grant/Award Number: 81860450; Basic Research Project in Guizhou Province, Grant/Award Numbers: [2018]1425, [2021] YB473, [2023]552; Young Talents Found of Zunyi Medical University, Grant/Award Number: 18zy‐005 Abstract Protein phosphatase magnesium‐dependent 1B (PPM1B) functions as IKKβ phosphatases to terminate nuclear factor kappa B (NF‐κB) signaling.. NF‐κB signaling was constitutively activated in glioma cells.. At present, little is known about the role of PPM1B in glioma. Article Title: PARP1-driven repair of topoisomerase IIIα DNA-protein crosslinks by FEN1 Article Snippet: shRNA oligonucleotides targeting human FEN1, using following primers were cloned into |